Parasitism of the root knot nematode Meloidogyne incognita (Kofoid and White) chitwood in five wild Solanaceae species
Parasitismo del nematodo agallador de la raíz (Meloidogyne incognita) en cinco especies de solanáceas silvestres
DOI:
https://doi.org/10.15446/rfna.v71n1.67122Keywords:
Solanaceae, Resistance, Susceptibility, Tolerance, Nematode (en)Solanácea, Resistencia, Susceptibilidad, Tolerancia, Nematodo (es)
There is a high incidence of the nematode Meloidogyne incognita in several economically important species of Solanaceae. This nematode causes damage to the roots, leading even to the death of
the plant, causing economic losses for the producer. This research was carried out in greenhouse to assess the response of five species of wild Solanaceae (Solanum auriculatum, S.hirtum, S.hispidum,
S.arboreum and Nicotiana glauca) to the infestation of M. incognita was evaluated. A randomized block design with three replicates was used. The initial inoculum was obtained from infested roots of tree
tomato (S. betaceum Cav.), which was propagated in kidney tomato plants (Lycopersicum esculentum Mill.) hibrid ‘Sheila’ which was used to inoculate the wild Solanaceae plus two susceptible controls (S. betaceum and S. quitoense) were inoculated with a dose of 2500 larvae. According to the reproduction factor of the nematode, S. arboreum, S. hirtum and N. glauca showed resistance because obtained values less than 1. In addition, S. hirtum (14.88) and N. glauca (22.67) showed the lowest number of root knots. In terms of foliage yield (dry weight), a response of tolerance was observed in all species except for the controls. It can be concluded that S. hirtum (compatible with S. quitoense - naranjilla) and N. glauca (compatible with S. betaceum - tree tomato) might be used as rootstocks of Solanaceae fruit crops of commercial importance in Ecuador, contributing to the integrated fruit production system.
Existe una alta incidencia del nematodo Meloidogyne incognita en varias especies Solanáceas de importancia económica. Este nematodo causa daño a las raíces, llevando incluso a la muerte
de la planta, causando pérdidas económicas para el productor. Esta investigación se llevó a cabo en invernadero para evaluar la respuesta de cinco especies de solanáceas silvestres (Solanum
auriculatum, S. hirtum, S. hispidum, S. arboreum y Nicotiana glauca) a la infestación de M. incognita. Se utilizó un diseño de bloques al azar con tres repeticiones. Se obtuvo el inóculo inicial de raíces infestadas de tomate de árbol (S. betaceum Cav.), el cual se propagó en tomate riñón (Lycopersicum esculentum Mill.) híbrido ‘Sheila’ y se inoculó las Solanáceas silvestres más dos controles susceptibles (S. betaceum y S. quitoense) con una dosis de 2500 larvas. De acuerdo al factor de reproducción del nematodo, S. arboreum, S. hirtum y N. glauca presentaron resistencia porque obtuvieron valores menor a 1. Además, S. hirtum (14,88) y N. glauca (22,67) presentaron el menor número de agallas en las raíces. En términos de rendimiento de follaje (peso seco), se observó una respuesta de tolerancia en todas las especies excepto en las plantas control. Se puede concluir que S. hirtum (compatible
con S. quitoense - naranjilla) y N. glauca (compatible con tomate de árbol -S. betaceum) podrían ser utilizados como portainjertos de Solanáceas de importancia comercial en Ecuador.
Recibido: 17 de agosto de 2017; Aceptado: 14 de septiembre de 2017
ABSTRACT
There is a high incidence of the nematode Meloidogyne incognita in several economically important species of Solanaceae. This nematode causes damage to the roots, leading even to the death of the plant, causing economic losses for the producer. This research was carried out in greenhouse to assess the response of five species of wild Solanaceae (Solanum auriculatum, S.hirtum, S.hispidum, S.arboreum and Nicotiana glauca) to the infestation of M. incognita was evaluated. A randomized block design with three replicates was used. The initial inoculum was obtained from infested roots of tree tomato (S. betaceum Cav.), which was propagated in kidney tomato plants (Lycopersicum esculentum Mill.) hibrid ‘Sheila’ which was used to inoculate the wild Solanaceae plus two susceptible controls (S. betaceum and S. quitoense) were inoculated with a dose of 2500 larvae. According to the reproduction factor of the nematode, S. arboreum, S. hirtum and N. glauca showed resistance because obtained values less than 1. In addition, S. hirtum (14.88) and N. glauca (22.67) showed the lowest number of root knots. In terms of foliage yield (dry weight), a response of tolerance was observed in all species except for the controls. It can be concluded that S. hirtum (compatible with S. quitoense - naranjilla) and N. glauca (compatible with S. betaceum - tree tomato) might be used as rootstocks of Solanaceae fruit crops of commercial importance in Ecuador, contributing to the integrated fruit production system.
Keywords:
Solanaceae, Resistance, Susceptibility, Tolerance, Nematode.RESUMEN
Existe una alta incidencia del nematodo Meloidogyne incognita en varias especies solanáceas de importancia económica. Este nematodo causa daño a las raíces, llevando incluso a la muerte de la planta, causando pérdidas económicas para el productor. Esta investigación se llevó a cabo en invernadero para evaluar la respuesta de cinco especies de solanáceas silvestres (Solanum auriculatum, S. hirtum, S. hispidum, S. arboreum y Nicotiana glauca) a la infestación de M. incognita. Se utilizó un diseño de bloques al azar con tres repeticiones. Se obtuvo el inóculo inicial de raíces infestadas de tomate de árbol (S. betaceum Cav.), el cual se propagó en tomate riñón (Lycopersicum esculentum Mill.) híbrido ‘Sheila’ y se inoculó las solanáceas silvestres más dos controles susceptibles (S. betaceum y S. quitoense) con una dosis de 2500 larvas. De acuerdo al factor de reproducción del nematodo, S. arboreum, S. hirtum y N. glauca presentaron resistencia porque obtuvieron valores menor a 1. Además, S. hirtum (14,88) y N. glauca (22,67) presentaron el menor número de agallas en las raíces. En términos de rendimiento de follaje (peso seco), se observó una respuesta de tolerancia en todas las especies excepto en las plantas control. Se puede concluir que S. hirtum (compatible con S. quitoense - naranjilla) y N. glauca (compatible con tomate de árbol -S. betaceum) podrían ser utilizados como portainjertos de Solanáceas de importancia comercial en Ecuador.
Palabras clave:
Solanaceae, Resistencia, Susceptibilidad, Tolerancia, Nematodo.Nematodes of the genus Meloidogyne are considered worldwide as a major pest because they are the most numerous multicellular organisms on earth (González et al., 2010).
Most of them are free-living and may be plant parasites and may become economically important in agricultural production, causing losses of more than 80% in areas of high infestation (Dong and Zhang, 2006; Guerena, 2006; Pakeerathan et al., 2009). Meloidogyne is a sedentary endoparasite that lives within the tissue and has a wide geographical distribution and forms root knots. There are more than 90 species of Meloidogyne identified, however M. arenaria, M. javanica, M. hapla and M. incognita are the most important because they cause major economic damage (De Jin et al., 2005; Rodríguez et al., 2009). Plants affected by nematodes showed symptomatology such as leaf yellowing, less growth and wilting and limited root development because of the formation of root knots, affecting the absorption of nutrients and decreasing yield (Daramola et al., 2015). Nematodes can interact with other diseases (i.e. Fusarium sp.) or breakdown genetic resistance to other enemies (Begum et al., 2012).
The control of nematodes has been generally done by the use of nematicides and soil fumigants. However, these products are no longer effective when populations of nematodes are high, in adittion they can also generate resistance and affect human health and the environment, and also reduce the biodiversity of the ecosystem (Akhtar and Malik, 2000; Pakeerathan et al., 2009). Currently, there is growing pressure to limit the use of agrochemicals (De Jin et al., 2005; Pakeerathan et al., 2009) and to develop environmentally friendly alternatives such as crop rotation, resistant cultivars, heat treatment, biological control and the application of organic amendments for good agronomic management (Castro et al., 2011). In this context, the use of rootstocks resistant to control this pest is a proposed option because had shown good results in agricultural crops (Marin et al., 2017).
The Solanaceae family contains approximately 96 genera and 2300 species including domesticated species and they have a cosmopolitan distribution, situated in tropical, subtropical and temperate climates at altitudes from 0 to 4000 m (Cuevas et al., 2008). The use of wild Solanaceae as rootstocks has been reported to prevent soil pest attack (Viteri et al., 2010). Different Solanaceae species have been reported showing resistance to M. incognita such as Solanum torvum, S. sisymbriifolium, S. erianthum and Datura stramonium (Rahman et al., 2002; Gonzáles et al., 2010).
The objective of this research was assessed the response of wild Solanaceae to nematode infestation caused by M. incognita, with the purpose of their subsequent use like rootstocks of Solanaceae fruit crops such as naranjilla (S. quitoense) and tree tomato (S. betaceum).
MATERIALS AND METHODS
Experimental location
The present research was carried out in the greenhouse of the Tumbaco Experimental Farm belonging to the Fruit Program (INIAP) and the nematological analysis in the Agrocalidad laboratories, located in the Quito Canton, Tumbaco Parish, Pichincha Province, at an altitude of 2348 m, latitude 0° 13' 0" S and longitude 78° 24'0" W. The average temperature in the greenhose varied from 12 °C to 32 °C and relative humidity was between 60 and 80%.
Inoculum of M. Incognita
The inoculum of M. incognita was obtained from the extract of infected roots of tree tomato plants. This procedure of extraction from roots used the technique of Stemerding (EPPO, 2016).
Identification of M. incognita
Morphometric identification was performed in J2 larvae obtained from infected tomato tree roots, using the taxonomic keys of Commonwealth Institute of Helminthology (Franklin, 1980). The specific primers MI-F GTGAGGATTCAGCTCCCCAG and MI-R ACGAGGAACATACTTCTCCGTCC (Meng et al., 2004)
were used for the species confirmation.
Inoculum multiplication
Kidney tomato seedlings (S. lycopersicum) hybrid 'Sheila', were used for the inoculum multiplication. These seedlings were inoculated by placing 20 ml of the extract obtained from infected roots of tree tomato in four holes (4 cm deep) around the seedling. Once the roots of the tomato seedlings were galled, oval egg masses were obtained.
Inoculum preparation and inoculation of wild Solanaceae seedlings.
Using an optical stereoscope, it was found eggs and larvae of M. incognita embedded in the oval masses. These masses were separated from the plant tissue and placed in petri dishes covered with a plastic mesh and filter paper containing distilled water. They remained for 72 hours at a temperature of 28 °C, during which nematode eggs hatched and nematode juveniles J2 emerged. A 5 mL aliquot of the suspension was taken to account for the existing larvae and adjusted to the inoculation dose (2500 larvae per container of 1 kg capacity). An amount of 20 mL of the inoculum solution was placed in four holes (4 cm deep) around each Solanaceae plant. Sterilized water was placed instead of the inoculum in non-inoculated plants (controls).
Solanaceas species and variables analyzed
Treatments were constituted by different species of wild Solanaceae: S. auriculatum Aiton, S. hirtum Vahl, S. hispidum Pers., S. arboreum Dunal and N. glauca Graham; including 2 susceptible species such as S. quitoense Lam. and S. betaceum Cav. (Table 1). All Solanaceas were planted in pots (1.1 L) containing Andean black soil plus pomex in a proportion of 2:1.
The recorded variables in this study were the following: Nematode final population: This was evaluated at 90 days after inoculation, at which time the plants showed nodulation in the roots. The roots of the different Solanaceae were processed by the Stemerding technique (EPPO, 2016) and then the final population of each treatment was counted.
Dry foliage weight (g): The fresh foliage of each seedling was placed in paper sleeves and dried in an oven at 60°C for 72 hours, then weighed using a digital scale.
Number of root knots: This variable was recorded at 90 days after inoculation by counting individually the number of knots in the roots of each seedling evaluated.
Statistical analysis
Data were analyzed using the statistical package R version 3.3.2. The 95% confidence intervals were estimated to determine the rate of increase of the nematode population based on the Poisson model.
When the reproduction factor (maximum value of the confidential interval/initial population) was less than 1 was considered resistant or superior than 1 was susceptible (Oostenbrink, 1966). With regard to host tolerance to nematode attack, a mean contrast (T test) was carried out between the yield (foliage dry weight) of the inoculated and non-inoculated plants for each Solanaceae, with the significance set at 5%. For number of root knots, the mean was estimated using the confidence interval at 95% and comparison of the means for Solanaceae was done through ANOVA, transforming the data by log transformation. The significance ranks were obtained by Duncan test at 5%.
RESULTS AND DISCUSSION
Identification of the nematode M. incognita
Individual larvae is obtained the following measurements: body length of 432.8 µm, body weight of 16.3 µm, stylet length of 10.2 µm and tail length of 42.1 µm; these measurements agree with those set by Eisenback et al. (1983). In adult females, the stylet cone was curved dorsally, and the anterior portion of the cone was cylindrical while the posterior was conical. In addition, specific primers MI-F and MI-R were used to amplify a band of 999 bp which confirmed the M. incognita species. Root knot nematodes (Meloidogyne spp.) are the most important nematode pests in the world, both because of their wide distribution and the high number of families and plant species that are affected (Gelpud, 2011), being the case of the commercial fruit crops in Ecuador such as tree tomato and naranjilla.
Evaluation of wild Solanaceae species inoculated with M. incognita
In Ecuador, fruit crops belonging to the Solanaceae family, such as tree tomato and naranjilla, have a high incidence of this nematode which causes damage to the plant and with the passage of the time can lead to death (Viteri et al., 2010). The estimated confidence interval for the nematode final population variable (Table 2) indicated that there was a resistance response by three species of wild Solanaceae (N. glauca, S. hirtum and S. arboreum) because their maximum value estimated in the confidence interval (1335, 1866 and 2484 larvae respectively) was inferior to the nematode initial population (2500 larvae) and the reproduction factor was less than 1. On the other hand, the control species (S. quitoense and S. betaceum) showed susceptibility because this value exceeded the initial population.
The high inter and intra-specific variability in the Meloidogyne populations favors their adaptability and gives greater selective advantages over their hosts, being several Solanaceae species host of this nematode (González et al., 2010) how was observed in this study. Host-plant resistance to plant-parasitic nematodes is defined as the suppressive effect of the plant on the nematode’s ability to reproduce (Cook and Evans, 1987). This definition of resistance in terms of reproduction of the nematode has been adopted by plant nematologists (Cook, 1974). The best sources of resistance to nematodes have been found in wild species that have no commercial value (Gonzáles et al., 2010). According to our results, N. glauca, S. hirtum and S. arboreum showed resistance (reproduction factor < 1), thus they can be considered as rootstocks that can be used in commercial Solanaceae such as tree tomato and naranjilla; however, S. arboreum showed a value very close to the initial population consequently the other two Solanaceae species are the best options. Piedra et al. (2005) demonstrated that a nematode resistance mechanism is considered good when it restricts or prevents the reproduction of nematodes how was observed in three Solanaceae species in this research. Unfortunately, the search for this type of plants requires years of research, an aspect that has limited the availability of resistant varieties (Anwar and McKenry, 2002).
Jacquet et al. (2005) and Devran (2004) have investigated the nematode resistance mechanism of the genus Meloidogyne spp. in tomato, concluding that the high amount of phenolic compounds synthesized in the plant and transferred to the roots confer resistance to nematode infestation. In addition, nematode-resistant plants have a higher level of phenylalanine ammonia, a key enzyme of phenolic metabolism known to be related to the resistance of plants to diseases (Sorribas et al., 2005). However, the sensitivity of a host depends not only on its genotype but on how many nematodes affect it. At high population densities the plants suffer a considerable reduction of their growth, but the sensitivity of the plant is also subject to the influence of the environment (Starr and Mercer, 2009).
On the other hand, Revelo and Sandoval (2003) demonstrated that the effect of a low initial population of M. incognita is easily supported by a Solanaceae species (S. quitoense) without decreasing its yield.
For the variable dry weight of the foliage (Table 3), a tolerance response to the nematode was found in all Solanaceae species except in the susceptible controls in which the p-values showed statistical significance at 5% (S. quitoense) and 1% (S. betaceum), indicating difference between the inoculated and non-inoculated plants (0.97 vs 1.23 and 1.03 vs 1.53, respectively).
The response to Solanaceae sensitivity was based on the Cook (1974) criteria where inoculated plants that show a lower dry weight (yield) than non-inoculated plants and also show statistic differences were considered non-tolerant. The same author mentions that tolerance is a genetic character independent of the resistance but can be present in resistant or susceptible plants; occurring in S. auriculatum and S. hispidun in our study. On the other hand, further research is need to visualize the plant tolerance response in terms of fruit production in field conditions.
Duncan test at 5% showed two ranges of significance for the variable number of root knots, where the species S. hirtum (14.88), N. glauca (22.67) and S. auriculatum (25.11) were located in the first range of significance with the lowest root knot values (Table 4).
All assessed Solanaceae species showed root knots, characteristic symptom of crops affected by nematodes of the genus Meloidogyne (González et al., 2010). In Table 4, it can be seen a variation in the number of root knots in the different species, which can be related to the study of Gonzales et al. (2010), who inoculated Solanaceas species with a dose of 2500 larvae, finding species that did not showed galling such as
S. torvum, S, erianthum and Datura stramonium and others that showed root knots as S. mammosum and L. esculentum. Oka et al. (2003) and Halbrendt (1996) mentioned that the decrease in root knot formation depends on the Meloidogyne species and also the plant species involved, the later can be seen in our study because there was a different number of root knots according to the species evaluated. According to Starr and Mercer (2009), the formation of root knots is not essential for the development of the nematode, therefore susceptible crops can show low levels of root knots and high nematode reproduction or vice versa; this can be confirmed with S. auriculatum which presented a low number of root knots (25.11) but its reproduction factor was greater than 1, showing susceptibility. Navarro et al. (2009) mentioned that the gall index should not be used as the only element to determine the resistance of a genotype or cultivar against M. incognita, even though it is considered an important element due to the damage caused by this pest. According to Gómez (2012), genetic resistance is one of the fundamental pillars of integrated pest management, thus grafted plants can be used to confer resistance to diseases and nematodes. According to our results, S. hirtum and S. glauca might be used as rootstocks because showed the best traits.
CONCLUSIONS
According to the reproduction factor, S. arboreum, S. hirtum and N. glauca showed resistance to the nematode M. incognita; however just the last two species showed a low number of root knots, for this reason they might be used as rootstocks for commercial Solanaceae fruit crops such as naranjilla and tree tomato, constituting an alternative to be involved in an integrated fruit production system.
ACKNOWLEDMENTS
Authors want to thank to Instituto Nacional de Investigaciones Agropecuarias and Agrocalidad for supporting this research, and Lyn Jackson for her assistance in the English edition of the manuscript.
REFERENCES
References
Akhtar M and Malik A. 2000. Roles of organic soil amendments and soil organisms in the biological control of plant-parasitic nematodes: a review. Bioresource Technology 74(1): 35-47. doi: 10.1016/S0960-8524(99)00154-6
Anwar SA and Mckenry MV. 2002. Penetration, development, and reproduction of Meloidogyne arenaria two new grape rootstocks. Journal of Nematology 34(2): 143-145.
Begum N, Haque M, Mukhtar T, Naqvi S and Wang J. 2012. Status of bacterial wilt caused by Ralstonia solanacearum in Pakistan. Pakistan Journal of Phytopathology 24(1): 11-20.
Castro L, Flores L and Uribe L. 2011. Efecto de vermicompost y quitina sobre el control de Meloidogyne incognita en tomate a nivel de invernadero. Agronomía Costarricense 35(2): 21-32.
Cuevas CT, Vargas O and Rodríguez A. 2008. Solanaceae diversity in the State of Jalisco, México. Revista Mexicana de Biodiversidad 79(1): 67-79.
Cook R. 1974. Nature and inheritance of nematode resistance in cereals. Journal of Nematology. 6(4): 165-174.
Cook R and Evans K. 1987. Resistance and tolerance. pp. 179-231. En Brown RH and Kerry BR (eds). Principles and practice of nematode control in crops. Academic Press, Marrickville. 447 p.
Daramola F, Popoola J, Eni A and Sulaiman O. 2015. Characterization of root knot nematodes (Meloidogyne spp.) associated with Abelmoschus escolentus, Celosia argentea and Corchorus olitorius. Asian Journal of Biological Sciencie 8: 42-50. doi: 10.3923/ajbs.2015.42.50
De Jin, R, Suh J, Park R and Kim Y. 2005. Effect of chitin compost and broth on biological control of Meloidogyne incognita on tomato (Lycopersicon esculentum Mill.). Nematology 7(1): 125-132. doi: 10.1163/1568541054192171
Devran Z. 2004. The screening of F2 plants for the root knot nematode resistance gene, Mi by PCR in Tomato. Turkish Journal of Agriculture & Forestry 28(4): 253-257.
Dong L and Zhang Q. 2006. Microbial control of plant- parasitic nematodes: a five-party interaction. Plant Soil 288(1-2): 31–45. doi: 10.1007/s11104-006-9009-3
Eisenback, J, Hirschmann H, Sasser J and Triantaphyllou A. 1983. Guía para la identificación de las cuatro especies más comunes de nematodo agallador (Meloidogyne especies) con una clave pictórica. North Carolina, USA: International Meloidogyne Proyect. 40 p.
European and Mediterranean Plant Protection Organization (EPPO). 2016. PM 7/41 (3) Meloidogyne chitwoodi and Meloidogyne fallax. EPPO Bulletin 46(1): 171–189. doi: 10.1111/epp.12292
Franklin M T. 1980. Nematology at the Commonwealht Institute of Helminthology. EPPO Bulletin 10(3): 409-410. doi: 10.111/j.1365-2338.1980.tb02717.x
Gelpud C, Mora E, Salazar C and Betancourth C. 2011. Susceptibilidad de genotipos de Solanum spp. al nematodo causante del nudo radical Meloidogyne spp. (Chitwood). Acta Agronómica 60(1): 50-67.
Gómez L, Enrique R, Hernández-Ochandia D, Miranda I, González E, Peteira B, and Rodríguez M. 2012. Susceptibilidad de genotipos de Solanum lycopersicum frente a Meloidogyne incognita Kofoid y White (Chitwood). Revista de Protección Vegetal 27(2): 111-116.
González F M, Gómez L, Rodríguez M G, Piñón M, Casanova A, Gómez O and Rodríguez Y. 2010. Respuesta de genotipos de solanáceas frente a Meloidogyne incognita (Kofoid y White) Critwood Raza 2 y M. areanaria (Neal) Chitwood. Revista de Protección Vegetal 25(1): 51-57.
Halbrendt J M. 1996. Allelopathy in themanagement of plantparasitic nematodes. Journal of Nematology 28(1): 8 -14.
Jacquet M, Bongiovanni M, Martínez M, Verschave P, Wajnberg E and Castagnone-Sereno P. 2005. Variation in resistance to the root-knot nematode Meloidogyne incognita in tomato genotypes bearing the Mi gene. Plant Pathology 54(2): 93-99. doi: 10.1111/j.1365-3059.2005.01143.x
Marin M, Santos L, Gaion L, Rabelo H, Franco C, Diniz G, Silva E and Braz L. 2017. Selection of resistant rootstocks to Meloidogyne enterolobii and M. incognita for okra (Abelmoschus esculentus L. Moench). Chilean Journal of Agricultural Research 77(1): 58-64. doi: 10.4067/so718-58392017000100007
Meng Q, Long H and Xu J. 2004. PCR assay for rapid and sensitive identification of three major root-knot nematodes, M. incognita, M. javanica and M. arenaria. Acta Phitopatologica Sinica 34(1): 204-210.
Navarro-Barthelemy L, Gómez L, Enrique R, González FM and Rodríguez MG. 2009. Comportamiento de genotipos de tomate (Solanum lycopersicum L.) frente a Meloidogyne incognita (Kofoid y White) Chitwood. Revista de Protección Vegetal 24(1): 54-57.
Oka Y, Karssen G and Mor M. 2003. Identification, host range and infection process of Meloidogyne marylandi from turf grass in Israel. Nematology 5(5): 727-734. doi: 10.1163/156854103322746904
Oostenbrink M. 1966. Mayor characteristics of the relation between nematodes and plants. Mededelingen 66(1): 1-46.
Pakeerathan K, Mikunthan G and Tharsani N. 2009. Effect of different animal manures on Meloidogyne incognita (Kofoid and White) on Tomato. World Journal of Agricultural Sciences 5(4): 432-435.
Piedra A, Díez M, Robertson L, López J, Escuer M and De León L. 2005. Comportamiento de Meloidogyne incognita sobre tomate y pimiento resistente en Uruguay. Nematropica 35(2): 111-120.
Rahman MA, Rashid MA, Salam MA, Masud MAT, Masum ASMH and Hossain MM. 2002. performance of some grafted eggplant genotypes on wild Solanum root stocks against root – knot nematode. Online Journal Biological Sciences 2(7): 446-448.
Revelo J and Sandoval P. 2003. Factores que afectan la producción y productividad de la naranjilla (Solanum quitoense Lam.) en la región amazónica del Ecuador. INIAP, Quito. 117 p.
Rodríguez MG, Gómez L, González FM, Carrillo Y, Piñón M, Gómez O, Casanova AS, Álvarez M and Peteira B. 2009. Comportamiento de genotipos de la familia Solanaceae frente a Meloidogyne incognita (Kofoid y White) CHITWOOD. Revista de Protección Vegetal 24(3): 137-145.
Sorribas FJ, Ornat C, Verdejo-Lucas S, Galeano M and Valero J. 2005. Effectiveness and profitability of the Mi-resistant tomatoes to control root-knot nematodes. European Journal of Plant Patholgy 111(1): 29-38. doi: 10.1007/s10658-004-1982-x.
Starr JL and Mercer CF. 2009. Development of resistant varieties. pp. 326-337. In Perry RN, Moens M and Starr JL (eds). Root-Knot nematodes. CABI Publishing, Wallingford. 488 p.
Viteri P, León J, Vásquez W, Encalada C, Martínez A, Revelo J, Posso M and Hinojosa. M. 2010. Solanáceas silvestres utilizadas como portainjertos de tomate de árbol (Solanum betaceum Cav.) con alto rendimiento, resistencia a enfermedades y mayor longevidad. INIAP, Quito. 23 p.
How to Cite
APA
ACM
ACS
ABNT
Chicago
Harvard
IEEE
MLA
Turabian
Vancouver
Download Citation
CrossRef Cited-by
1. Patricio Castro Quezada, Lourdes Díaz Granda, Luis Pacheco Atariguana. (2022). Capacidad hospedante de tres especies de solanáceas de la sección Lasiocarpa al nematodo agallador de la raíz Meloidogyne incognita. La Granja, 37(1) https://doi.org/10.17163/lgr.n37.2023.03.
2. Pedro Mendoza-de Gives. (2022). Soil-Borne Nematodes: Impact in Agriculture and Livestock and Sustainable Strategies of Prevention and Control with Special Reference to the Use of Nematode Natural Enemies. Pathogens, 11(6), p.640. https://doi.org/10.3390/pathogens11060640.
3. Tsobedi Absalom Masenya, Thembelihle Ellain Mdluli, Setshele Standford Thosago, Zakheleni Palane Dube, Mmagadima Lauraine Sebati. (2023). Host status and host sensitivity of Kickapoo white tepary bean to Meloidogyne enterolobii . Acta Agriculturae Scandinavica, Section B — Soil & Plant Science, 73(1), p.88. https://doi.org/10.1080/09064710.2023.2195866.
Dimensions
PlumX
Article abstract page views
Downloads
License
Copyright (c) 2017 Revista Facultad Nacional de Agronomía Medellín
This work is licensed under a Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International License.
The journal allows the author(s) to maintain the exploitation rights (copyright) of their articles without restrictions. The author(s) accept the distribution of their articles on the web and in paper support (25 copies per issue) under open access at local, regional, and international levels. The full paper will be included and disseminated through the Portal of Journals and Institutional Repository of the Universidad Nacional de Colombia, and in all the specialized databases that the journal considers pertinent for its indexation, to provide visibility and positioning to the article. All articles must comply with Colombian and international legislation, related to copyright.
Author Commitments
The author(s) undertake to assign the rights of printing and reprinting of the material published to the journal Revista Facultad Nacional de Agronomía Medellín. Any quotation of the articles published in the journal should be made given the respective credits to the journal and its content. In case content duplication of the journal or its partial or total publication in another language, there must be written permission of the Director.
Content Responsibility
The Faculty of Agricultural Sciences and the journal are not necessarily responsible or in solidarity with the concepts issued in the published articles, whose responsibility will be entirely the author or the authors.