Revista Facultad Nacional de Agronomía Medellín

Experimental location

The present research was carried out in the greenhouse of the Tumbaco Experimental Farm belonging to the Fruit Program (INIAP) and the nematological analysis in the Agrocalidad laboratories, located in the Quito Canton, Tumbaco Parish, Pichincha Province, at an altitude of 2348 m, latitude 0° 13' 0" S and longitude 78° 24'0" W. The average temperature in the greenhose varied from 12 °C to 32 °C and relative humidity was between 60 and 80%.

Inoculum of M. Incognita

The inoculum of M. incognita was obtained from the extract of infected roots of tree tomato plants. This procedure of extraction from roots used the technique of Stemerding (EPPO, 2016).

Identification of M. incognita

Morphometric identification was performed in J2 larvae obtained from infected tomato tree roots, using the taxonomic keys of Commonwealth Institute of Helminthology (Franklin, 1980). The specific primers MI-F GTGAGGATTCAGCTCCCCAG and MI-R ACGAGGAACATACTTCTCCGTCC (Meng et al., 2004)

were used for the species confirmation.

Inoculum multiplication

Kidney tomato seedlings (S. lycopersicum) hybrid 'Sheila', were used for the inoculum multiplication. These seedlings were inoculated by placing 20 ml of the extract obtained from infected roots of tree tomato in four holes (4 cm deep) around the seedling. Once the roots of the tomato seedlings were galled, oval egg masses were obtained.

Inoculum preparation and inoculation of wild Solanaceae seedlings.

Using an optical stereoscope, it was found eggs and larvae of M. incognita embedded in the oval masses. These masses were separated from the plant tissue and placed in petri dishes covered with a plastic mesh and filter paper containing distilled water. They remained for 72 hours at a temperature of 28 °C, during which nematode eggs hatched and nematode juveniles J2 emerged. A 5 mL aliquot of the suspension was taken to account for the existing larvae and adjusted to the inoculation dose (2500 larvae per container of 1 kg capacity). An amount of 20 mL of the inoculum solution was placed in four holes (4 cm deep) around each Solanaceae plant. Sterilized water was placed instead of the inoculum in non-inoculated plants (controls).

Solanaceas species and variables analyzed

Treatments were constituted by different species of wild Solanaceae: S. auriculatum Aiton, S. hirtum Vahl, S. hispidum Pers., S. arboreum Dunal and N. glauca Graham; including 2 susceptible species such as S. quitoense Lam. and S. betaceum Cav. (Table 1). All Solanaceas were planted in pots (1.1 L) containing Andean black soil plus pomex in a proportion of 2:1.

Table 1: Solanaceae species assessed against the parasitism of M. incognita.

The recorded variables in this study were the following: Nematode final population: This was evaluated at 90 days after inoculation, at which time the plants showed nodulation in the roots. The roots of the different Solanaceae were processed by the Stemerding technique (EPPO, 2016) and then the final population of each treatment was counted.

Dry foliage weight (g): The fresh foliage of each seedling was placed in paper sleeves and dried in an oven at 60°C for 72 hours, then weighed using a digital scale.

Number of root knots: This variable was recorded at 90 days after inoculation by counting individually the number of knots in the roots of each seedling evaluated.

Statistical analysis

Data were analyzed using the statistical package R version 3.3.2. The 95% confidence intervals were estimated to determine the rate of increase of the nematode population based on the Poisson model.

When the reproduction factor (maximum value of the confidential interval/initial population) was less than 1 was considered resistant or superior than 1 was susceptible (Oostenbrink, 1966). With regard to host tolerance to nematode attack, a mean contrast (T test) was carried out between the yield (foliage dry weight) of the inoculated and non-inoculated plants for each Solanaceae, with the significance set at 5%. For number of root knots, the mean was estimated using the confidence interval at 95% and comparison of the means for Solanaceae was done through ANOVA, transforming the data by log transformation. The significance ranks were obtained by Duncan test at 5%.

Identification of the nematode M. incognita

Individual larvae is obtained the following measurements: body length of 432.8 µm, body weight of 16.3 µm, stylet length of 10.2 µm and tail length of 42.1 µm; these measurements agree with those set by Eisenback et al. (1983). In adult females, the stylet cone was curved dorsally, and the anterior portion of the cone was cylindrical while the posterior was conical. In addition, specific primers MI-F and MI-R were used to amplify a band of 999 bp which confirmed the M. incognita species. Root knot nematodes (Meloidogyne spp.) are the most important nematode pests in the world, both because of their wide distribution and the high number of families and plant species that are affected (Gelpud, 2011), being the case of the commercial fruit crops in Ecuador such as tree tomato and naranjilla.

Evaluation of wild Solanaceae species inoculated with M. incognita

In Ecuador, fruit crops belonging to the Solanaceae family, such as tree tomato and naranjilla, have a high incidence of this nematode which causes damage to the plant and with the passage of the time can lead to death (Viteri et al., 2010). The estimated confidence interval for the nematode final population variable (Table 2) indicated that there was a resistance response by three species of wild Solanaceae (N. glauca, S. hirtum and S. arboreum) because their maximum value estimated in the confidence interval (1335, 1866 and 2484 larvae respectively) was inferior to the nematode initial population (2500 larvae) and the reproduction factor was less than 1. On the other hand, the control species (S. quitoense and S. betaceum) showed susceptibility because this value exceeded the initial population.

Table 2: Resistance or susceptibility response based on the nematode final population obtained in Solanaceae inoculated with M. incognita.

The high inter and intra-specific variability in the Meloidogyne populations favors their adaptability and gives greater selective advantages over their hosts, being several Solanaceae species host of this nematode (González et al., 2010) how was observed in this study. Host-plant resistance to plant-parasitic nematodes is defined as the suppressive effect of the plant on the nematode’s ability to reproduce (Cook and Evans, 1987). This definition of resistance in terms of reproduction of the nematode has been adopted by plant nematologists (Cook, 1974). The best sources of resistance to nematodes have been found in wild species that have no commercial value (Gonzáles et al., 2010). According to our results, N. glauca, S. hirtum and S. arboreum showed resistance (reproduction factor < 1), thus they can be considered as rootstocks that can be used in commercial Solanaceae such as tree tomato and naranjilla; however, S. arboreum showed a value very close to the initial population consequently the other two Solanaceae species are the best options. Piedra et al. (2005) demonstrated that a nematode resistance mechanism is considered good when it restricts or prevents the reproduction of nematodes how was observed in three Solanaceae species in this research. Unfortunately, the search for this type of plants requires years of research, an aspect that has limited the availability of resistant varieties (Anwar and McKenry, 2002).

Jacquet et al. (2005) and Devran (2004) have investigated the nematode resistance mechanism of the genus Meloidogyne spp. in tomato, concluding that the high amount of phenolic compounds synthesized in the plant and transferred to the roots confer resistance to nematode infestation. In addition, nematode-resistant plants have a higher level of phenylalanine ammonia, a key enzyme of phenolic metabolism known to be related to the resistance of plants to diseases (Sorribas et al., 2005). However, the sensitivity of a host depends not only on its genotype but on how many nematodes affect it. At high population densities the plants suffer a considerable reduction of their growth, but the sensitivity of the plant is also subject to the influence of the environment (Starr and Mercer, 2009).

On the other hand, Revelo and Sandoval (2003) demonstrated that the effect of a low initial population of M. incognita is easily supported by a Solanaceae species (S. quitoense) without decreasing its yield.

For the variable dry weight of the foliage (Table 3), a tolerance response to the nematode was found in all Solanaceae species except in the susceptible controls in which the p-values showed statistical significance at 5% (S. quitoense) and 1% (S. betaceum), indicating difference between the inoculated and non-inoculated plants (0.97 vs 1.23 and 1.03 vs 1.53, respectively).

Table 3: Response for the variable dry weight of foliage observed in Solanaceae inoculated with M. incognita.

The response to Solanaceae sensitivity was based on the Cook (1974) criteria where inoculated plants that show a lower dry weight (yield) than non-inoculated plants and also show statistic differences were considered non-tolerant. The same author mentions that tolerance is a genetic character independent of the resistance but can be present in resistant or susceptible plants; occurring in S. auriculatum and S. hispidun in our study. On the other hand, further research is need to visualize the plant tolerance response in terms of fruit production in field conditions.

Duncan test at 5% showed two ranges of significance for the variable number of root knots, where the species S. hirtum (14.88), N. glauca (22.67) and S. auriculatum (25.11) were located in the first range of significance with the lowest root knot values (Table 4).

Table 4: Number of root knots counted in the different Solanaceae inoculated with the nematode M. incognita.

All assessed Solanaceae species showed root knots, characteristic symptom of crops affected by nematodes of the genus Meloidogyne (González et al., 2010). In Table 4, it can be seen a variation in the number of root knots in the different species, which can be related to the study of Gonzales et al. (2010), who inoculated Solanaceas species with a dose of 2500 larvae, finding species that did not showed galling such as

S. torvum, S, erianthum and Datura stramonium and others that showed root knots as S. mammosum and L. esculentum. Oka et al. (2003) and Halbrendt (1996) mentioned that the decrease in root knot formation depends on the Meloidogyne species and also the plant species involved, the later can be seen in our study because there was a different number of root knots according to the species evaluated. According to Starr and Mercer (2009), the formation of root knots is not essential for the development of the nematode, therefore susceptible crops can show low levels of root knots and high nematode reproduction or vice versa; this can be confirmed with S. auriculatum which presented a low number of root knots (25.11) but its reproduction factor was greater than 1, showing susceptibility. Navarro et al. (2009) mentioned that the gall index should not be used as the only element to determine the resistance of a genotype or cultivar against M. incognita, even though it is considered an important element due to the damage caused by this pest. According to Gómez (2012), genetic resistance is one of the fundamental pillars of integrated pest management, thus grafted plants can be used to confer resistance to diseases and nematodes. According to our results, S. hirtum and S. glauca might be used as rootstocks because showed the best traits.